|
Bioss
rabbit anti cebp beta polyclonal antibody Rabbit Anti Cebp Beta Polyclonal Antibody, supplied by Bioss, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/rabbit+polyclonal+%CE%B2/pmc13158677-61-23-29?v=Bioss Average 90 stars, based on 1 article reviews
rabbit anti cebp beta polyclonal antibody - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
OriGene
antibodies against s100 Antibodies Against S100, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/rabbit+polyclonal+%CE%B2/pm42103358-115-8-11?v=OriGene Average 94 stars, based on 1 article reviews
antibodies against s100 - by Bioz Stars,
2026-07
94/100 stars
|
Buy from Supplier |
|
Affinity Biosciences
rabbit anti mouse β tubulin polyclonal antibodies Rabbit Anti Mouse β Tubulin Polyclonal Antibodies, supplied by Affinity Biosciences, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/rabbit+polyclonal+%CE%B2/pm42092476-64-7-15?v=Affinity+Biosciences Average 86 stars, based on 1 article reviews
rabbit anti mouse β tubulin polyclonal antibodies - by Bioz Stars,
2026-07
86/100 stars
|
Buy from Supplier |
|
Bioss
rabbit anti β actin antibody ![]() Rabbit Anti β Actin Antibody, supplied by Bioss, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/rabbit+polyclonal+%CE%B2/pmc13165423-145-0-7?v=Bioss Average 97 stars, based on 1 article reviews
rabbit anti β actin antibody - by Bioz Stars,
2026-07
97/100 stars
|
Buy from Supplier |
|
Bioss
tgf beta 1 rabbit ![]() Tgf Beta 1 Rabbit, supplied by Bioss, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/rabbit+polyclonal+%CE%B2/pm41998638-290-32-36?v=Bioss Average 95 stars, based on 1 article reviews
tgf beta 1 rabbit - by Bioz Stars,
2026-07
95/100 stars
|
Buy from Supplier |
|
Affinity Biosciences
anti β actin rabbit polyclonal antibody ![]() Anti β Actin Rabbit Polyclonal Antibody, supplied by Affinity Biosciences, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/rabbit+polyclonal+%CE%B2/pmc13113316-89-43-47?v=Affinity+Biosciences Average 86 stars, based on 1 article reviews
anti β actin rabbit polyclonal antibody - by Bioz Stars,
2026-07
86/100 stars
|
Buy from Supplier |
|
Bioss
rabbit anti β actin ![]() Rabbit Anti β Actin, supplied by Bioss, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/rabbit+polyclonal+%CE%B2/pm41955096-376-43-46?v=Bioss Average 97 stars, based on 1 article reviews
rabbit anti β actin - by Bioz Stars,
2026-07
97/100 stars
|
Buy from Supplier |
|
OriGene
resource source identifier 186 hactb qf caccattggcaatgagcggttc origene nm 001101 187 hactb qr ![]() Resource Source Identifier 186 Hactb Qf Caccattggcaatgagcggttc Origene Nm 001101 187 Hactb Qr, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/rabbit+polyclonal+%CE%B2/pm41931389-277-2-8?v=OriGene Average 94 stars, based on 1 article reviews
resource source identifier 186 hactb qf caccattggcaatgagcggttc origene nm 001101 187 hactb qr - by Bioz Stars,
2026-07
94/100 stars
|
Buy from Supplier |
|
Proteintech
rabbit ![]() Rabbit, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/rabbit+polyclonal+%CE%B2/pmc12721180-11-5-9?v=Proteintech Average 96 stars, based on 1 article reviews
rabbit - by Bioz Stars,
2026-07
96/100 stars
|
Buy from Supplier |
|
Proteintech
β catenin rabbit polyclonal antibody ![]() β Catenin Rabbit Polyclonal Antibody, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/rabbit+polyclonal+%CE%B2/pmc12907233-92-26-32?v=Proteintech Average 96 stars, based on 1 article reviews
β catenin rabbit polyclonal antibody - by Bioz Stars,
2026-07
96/100 stars
|
Buy from Supplier |
Journal: Plants
Article Title: Anti-Inflammatory Properties of Garrya flavescens : Phytochemical Profiling and Mitigation of LPS-Induced Neuroinflammation via ERK Signaling and Mitochondrial Modulation
doi: 10.3390/plants15091319
Figure Lengend Snippet: Signaling pathways of Garrya flavescens extract under LPS treatment in microglia. ( A ) Western blot analysis of BV-2 cells pre-treated with vehicle or GF, followed by LPS treatment at 10, 30 and 60 min. Antibodies against phosphorylated ERK, p38, AKT and β-Actin were used. ( B – D ) Quantitative analysis of the band intensities: p-ERK/β-Actin ( B ), p-p38/β-Actin ( C ), and p-AKT/β-Actin ( D ). * p < 0.05; ** p < 0.01; Student’s t -test. N = 3 independent cultures. Bars indicate mean ± SD. Abbreviations: GF, Garrya flavescens ; LPS, lipopolysaccharide; CGA, chlorogenic acid; ERK, extracellular signal-regulated kinase; p38, p38 mitogen-activated protein kinase; AKT, protein kinase B; β-actin, beta-actin.
Article Snippet:
Techniques: Protein-Protein interactions, Western Blot
Journal: Biomedicines
Article Title: Ionic Extracts of Magnesium Powders Promote In Vitro Lymphangiogenesis
doi: 10.3390/biomedicines14040913
Figure Lengend Snippet: Effects of magnesium extracts on lymphangiogenesis-related gene and protein expression in LECs. ( A ) Relative Vegfa mRNA expression levels in LECs treated with Control, Mg (1:10), Mg (1:100), and Mg (1:1000), as determined by qRT-PCR. ( B ) Relative Vegfc mRNA expression levels in LECs under the same treatment conditions. ( C ) Representative Western blot images showing VEGFA and VEGFC protein expression in LECs after treatment with different concentrations of magnesium extracts, with GAPDH used as the internal loading control. ( D ) Additional Western blot analysis showing VEGFR3 protein expression under the same treatment conditions, with β-actin used as the internal loading control. Data in ( A , B ) are presented as the mean ± SD ( n = 3). Statistical analysis for ( A , B ) was performed using one-way ANOVA followed by Tukey’s multiple-comparisons test. Statistical significance is indicated as * p < 0.05, ** p < 0.01; ns, not significant.
Article Snippet: The primary antibodies used in this study included anti-VEGFA rabbit polyclonal antibody (ZEN-BIOSCIENCE Co., Ltd., Chengdu, China), anti-VEGFC rabbit polyclonal antibody (ZEN-BIOSCIENCE Co., Ltd., Chengdu, China), anti-VEGFR3 rabbit polyclonal antibody (Affinity Biosciences, Shanghai, China), anti-GAPDH rabbit polyclonal antibody (Affinity Biosciences, Shanghai, China), and
Techniques: Expressing, Control, Quantitative RT-PCR, Western Blot
Journal: Poultry Science
Article Title: Frizzled-4 promotes bone formation in chickens via activation of the canonical Wnt signaling pathway
doi: 10.1016/j.psj.2026.106589
Figure Lengend Snippet: Effects of FZD4 overexpression and knockdown on the expression of key factors in the canonical Wnt signaling pathway. (A-B) Relative expression of signaling pathway key factors C-myc, CyclinD1, β-catenin , and GSK-3β in chicken BMSCs at 0 and 7 days post-osteogenic differentiation. n = 6. (C) Western blot analysis of FZD4, GSK-3β, and β-catenin protein levels at 36 hours post-differentiation induction. (D-E) Band intensity analysis of FZD4, GSK-3β, and β-catenin proteins. n = 3. (F-G) Relative expression of key signaling pathway factors C-myc, CyclinD1, β-catenin , and GSK-3β in chicken BMSCs at 0 and 7 days post-osteogenic differentiation. n = 6. (H) Western blot analysis of FZD4, GSK-3β, and β-catenin protein levels at 36 hours post-differentiation induction. (I-J) Grayscale analysis of FZD4, GSK-3β, and β-catenin protein bands. Band intensity was analyzed using ImageJ software. * P < 0.05, ** P < 0.01. n = 3.
Article Snippet: The primary antibodies used were FZD4 rabbit polyclonal antibody (1:2000, bs-13217R, Bioss), Glycogen synthase kinase 3 beta ( GSK-3β ) rabbit polyclonal antibody (1:2000, 51065-1-AP, Proteintech),
Techniques: Over Expression, Knockdown, Expressing, Western Blot, Software
Journal: Poultry Science
Article Title: Frizzled-4 promotes bone formation in chickens via activation of the canonical Wnt signaling pathway
doi: 10.1016/j.psj.2026.106589
Figure Lengend Snippet: Effects of overexpressing FZD4 while inhibiting the canonical Wnt signaling pathway on the osteogenic differentiation of chicken BMSCs. (A-B) Relative expression of osteogenic marker genes Col1A1, Runx2, ALP , and OCN in chicken BMSCs at 0 and 7 days post-osteogenic differentiation. n = 6. (C-D) Relative expression of key signaling pathway factors C-myc, CyclinD1, β-catenin , and GSK-3β in chicken BMSCs at 0 and 7 days post-osteogenic differentiation. n = 6. (E-G) Western blot analysis of β-catenin and GSK-3β protein levels at 36 h post-differentiation induction. Protein band grayscale analysis was performed using ImageJ software. n = 3. (H-I) ALP staining images (Scale bar = 100 μm) and grayscale analysis at 7 days post-induction. n = 4. (J-K) ARS staining (Scale bar = 100 μm) and grayscale analysis at 14 days post-induction. * P < 0.05, ** P < 0.01. n = 4.
Article Snippet: The primary antibodies used were FZD4 rabbit polyclonal antibody (1:2000, bs-13217R, Bioss), Glycogen synthase kinase 3 beta ( GSK-3β ) rabbit polyclonal antibody (1:2000, 51065-1-AP, Proteintech),
Techniques: Expressing, Marker, Western Blot, Software, Staining
Journal: Poultry Science
Article Title: Frizzled-4 promotes bone formation in chickens via activation of the canonical Wnt signaling pathway
doi: 10.1016/j.psj.2026.106589
Figure Lengend Snippet: Effects of knockdown FZD4 while inhibiting the canonical Wnt signaling pathway on the osteogenic differentiation of chicken BMSCs. (A-B) Relative expression of osteogenic marker genes Col1A1, Runx2, ALP , and OCN in chicken BMSCs at 0 and 7 days post-osteogenic differentiation. n = 6. (C-D) Relative expression of key signaling pathway factors C-myc, CyclinD1, β-catenin , and GSK-3β in chicken BMSCs at 0 and 7 days post-osteogenic differentiation. n = 6. (E-G) Western blot analysis of β-catenin and GSK-3β protein levels at 36 h post-differentiation induction. Protein band grayscale analysis was performed using ImageJ software. n = 3. (H-I) ALP staining images (Scale bar = 100 μm) and grayscale analysis at 7 days post-induction. n = 4. (J-K) ARS staining (Scale bar = 100 μm) and grayscale analysis at 14 days post-induction. * P < 0.05, ** P < 0.01. n = 4.
Article Snippet: The primary antibodies used were FZD4 rabbit polyclonal antibody (1:2000, bs-13217R, Bioss), Glycogen synthase kinase 3 beta ( GSK-3β ) rabbit polyclonal antibody (1:2000, 51065-1-AP, Proteintech),
Techniques: Knockdown, Expressing, Marker, Western Blot, Software, Staining